ATCG

Yeast GENOME EDITING USING CRISPR/Cas9

( derived from Laughery et al. 2015. Yeast. )

 

**Check before performing step 2! We usually have large amounts of plasmid stocked.**

**Do not forget to thaw yeast strains to be transformed and to prepare selection plates and reagents before step 9.**

 

1. Design Oligonucleotides

This protocol usually requires 3 different pairs of oligonucleotides.

  1. Design gRNA oligonucleotides targeted to your site of interest at http://wyrickbioinfo2.smb.wsu.edu/crispr.html. This tool gives good results but alternatively you can use http://www.e-crisp.org/E-CRISP/designcrispr.html or http://yeastriction.tnw.tudelft.nl/#!/. We also like https://crispr.cos.uni-heidelberg.de/. See comments at bottom of this page on the design of gRNA oligos.
  2. Design oligonucleotides for inserting the sequence of interest at the site of interest in the yeast genome (repair fragment).
  3. Design oligonucleotides for validation of clones by PCR and sequencing (primers located at least 50 bp outside the region of interest).

 

2. pGY513 Miniprep (or Midiprep)

  1. Grow pGY513 (pML104) overnight in 5 mL LB + 5 µL 100 mg/mL Ampicillin.
  2. Centrifuge and resuspend in 600 µL water. Use Macherey-Nagel miniprep kit (resuspend in ~30 µL).

                Note: pGY513 must be grown in a dam- cell type for the subsequent steps to work.

                         We usually store large amounts of pML104 (Midiprep) in the lab, so this step is optional.

 

**Check before performing step 3! We often have cut plasmid stocked.**

3. pGY513 Digestion

 The following procedure yields enough digested plasmid for ~40 ligation reactions. It is recommended to digest more plasmid than needed to reach sufficient concentration for ligations.

  1. Prepare a master mix with ~16 µg of pML104, 80 µL of buffer 3.1 (NEB), 16 µl Bcl1, 16 ul SwaI and milliQ H2O up to a final volume of 800 µL.
  2. Distribute 50 µL of mix in each well of two 8-well PCR strips.
  3. Digest at 25°C for ~2 hours and then 50°C for ~2 hours.
  4. Add 1 ul rSAP (Shrimp Alkaline Phosphatase) in each well and incubate at 37°C for 1 hour.
  5. Clean with Macherey-Nagel PCR clean-up kit. Add 100 µL buffer NTI in each well and combine four wells in one filter column (4 columns in total for the 16 wells). Elute twice in 13 µL EB buffer. The final concentration should be ~80 ng/µL (above 40 ng/µL).
  6. Use Nanodrop to get plasmid concentration. The final concentration should be ~80 ng/µL (above 40 ng/µL).
  7. Digestion can be confirmed on an agarose gel (optional).

 

4. gRNA oligonucleotides hybridization        

      To be done in the afternoon so the ligation can happen overnight.

  1. Thaw the gRNA oligonucleotides designed at in step 1. One oligo is 33 nt long and the other one is 37 nt long.
  2. Mix 1 µL of each primer at 100 µM, 1 µL of 10x T4 ligase buffer (NEB) and 0.5 µL T4 PNK in a 10 µL reaction.
  3. Incubate at 37°C for 30 minutes, 95°C for 5 minutes, then decrease by 1°C per minute to reach 25°C. Use program oligo-anneal2.js on PeqSTAR instrument located in Delattre lab.

 

5. Ligation

  1. Add 190 µL milliQ H2O to hybridized oligonucleotides.
  2. Mix ~100 ng of digested pGY513 vector (from step 2 or lab stocks) with 2 µl of 1/20 diluted hybridized oligos, 2.5 µl 10x T4 ligase buffer (NEB), 1 µl T4 ligase (Invitrogen) and fill up to 25 µl with milliQ H2
  3. Incubate overnight at 16C followed by 10 minutes at 65°C.

 

6. Transformation in Bacteria

 Important to do this in the morning after overnight ligation. Useful to perform a negative control (digested pGY513) and a positive control (pUC19 plasmid DNA).

  1. Thaw DH5α High Efficiency cells (NEB) on ice for five minutes.
  2. Gently mix cells with pipette tip (no vortex or pipetting up and down!!!) and aliquot 50 µL per transformation into microcentrifuge tubes on ice.
  3. Refreeze the leftover of competent cells in dry ice/ethanol mixture for 5 minutes before returning to –80°C freezer.
  4. Add 10 µL of ligation product to the cells (100 ng of digested pGY513 for negative control; 1 µL pUC19 plasmid for positive control). Gently mix with pipette tip.
  5. Incubate on ice for 30 minutes.
  6. Heat shock for 20 seconds at 42°C.
  7. Keep on ice for 2 minutes.
  8. Add 250 µL of SOC medium and incubate for 1 hour at 37°C with 225 rpm shaking.
  9. Plate 150 µL on LB+Amp and grow overnight at 37°C.

 

7. Miniprep and gRNA sequencing

It is recommended to miniprep 2 colonies for each transformation and to keep the remaining colonies in the fridge until the correct insertion is confirmed by sequencing.

  1. Grow 2 positive colonies for 12-16 hours in 5 mL LB + 5 µL 100 mg/ml Ampicillin.
  2. Use 3 mL of culture for Miniprep and keep the rest in the fridge for glycerol stock.
  3. Use Macherey-Nagel Miniprep kit and resuspend in 30 µL milliQ H2
  4. Use Nanodrop to get concentration. It should be around ~500 ng/µL. Anything below ~100 ng/µL is likely a false positive.
  5. Sequence Miniprep using primer 1P31 to confirm correct gRNA insertion.
  6. Prepare glycerol stock by mixing 800 µL of culture with 200 µL of 80% glycerol. Cultures can be kept up to five days at 4°C before doing the glycerol stock.

 

8. Prepare Repair Fragment

 The repair fragment is usually obtained by PCR, but in specific cases it can be obtained by oligonucleotides hybridization (following same procedure as in step 4 without PNK).

  1. One 50 µL PCR reaction is necessary for each transformation reaction.
  2. Mix ~10 ng of vector DNA or ~100 ng of genomic DNA template (no template for deletions), 5 µL 10x PfuUltra II reaction buffer, 5 µL dNTP mix (2.5 mM each dNTP), 1 µL forward primer at 10 µM, 1 µL reverse primer at 10 µM, 1 µL PfuUltra II fusion HS DNA polymerase and milliQ H2O up to a final volume of 50 µL.
  3. The PCR program is 95°C for 2 min, 30 cycles of 95°C for 20 s, 55°C (or Tm – 5°C) for 20 s, 72°C for 15 s/kb and final elongation at 72°C for 3 min.
  4. Check PCR product on 1% agarose gel (or 0.8% agarose if product is smaller than 200 bp). Store at 4°C up to one week.

 

9. Transformation in Yeast

Do not forget to thaw yeast strains to be transformed and to prepare selection plates and reagents a few days before transformation. Do not forget to turn on 42°C water bath before step 9C.

  1. Grow the yeast strain(s) to be transformed in 5 mL of YPD at 30°C overnight. If possible, it is best to start cultures from a patch on a YPG plate (5% glycerol).
  2. Dilute 200 µL of overnight culture into 5 mL of YPD and grow for an additional 4 hours at 30°C.
  3. Pellet cells by centrifuging at 3000 rpm for 5 minutes.
  4. Resuspend in 1 mL sterile H2O and transfer to a micro-centrifuge tube.
  5. Centrifuge for 1 min at 11,000 rpm and remove supernatant.
  6. Resuspend in 0.1 M LiAc, centrifuge for 1 min at 11,000 rpm and remove supernatant.
  7. Combine > 500 ng of plasmid from step 7 with > 1 µg of repair fragment to a final volume of 34 µL (usually 2 µL of plasmid + 32 µL of PCR product).
  8. Add to the cells 240 µL 50% PEG, 36 µL 1 M LiAc, 50 µL boiled Salmon sperm DNA (2 mg/mL) and 34 µL of plasmid / repair fragment mixture.
  9. Immediately vortex thoroughly until the pellet is dissolved. The pellet becomes difficult to resuspend after ~5 min in 50% PEG, so it is recommended to proceed with step 9I once step 9H was applied to 4 samples.
  10. Incubate at 30°C for 30 min, followed by 42°C for 30 min in water bath.
  11. Centrifuge at 11,000 rpm for 1 min and remove supernatant.
  12. Resuspend in 1 mL sterile H2O (be gentle, the pellet can be difficult to resuspend at this step, so take your time).
  13. Centrifuge at 11,000 rpm for 1 min, remove supernatant and resuspend in 110 µL sterile H2
  14. Plate 100 µL on SD-Ura medium. Add 90 µL sterile H2O to leftover and plate remaining 100 µL on a second SD-Ura plate.
  15. Grow at 30°C for 2 days (or keep on the bench if you cannot take care of the plates in the next 3 days).

 

10. Validation of transformants

  1. Streak several colonies for singles on fresh SD-Ura plates and grow at 30°C for 2 days. Up to 8 colonies can be streaked on the same plate. The number of colonies to be streaked depends on the expected rate of false positives (inversely correlated with the total number of colonies obtained). It is recommended to streak at least 8 colonies per transformation and up to 24 colonies for tricky transformation (eg. Insertions > 3 kb).
  2. Patch one colony from each streak on a YPG plate (5% glycerol) and grow at 30°C for 2 days. Up to 20 colonies can be patched on the same plate. Petite cells will not grow on YPG.
  3. Amplify the targeted genomic site by PCR using primers designed for validation as described below.
  4. Prepare a PCR master mix with 5 µL 5x One Taq buffer, 2.5 µL dNTP mix (2.5 mM each dNTP), 0.5 µL forward primer at 10 µM, 0.5 µL reverse primer at 10 µM, 0.15 µL One Taq polymerase and milliQ H2O up to a final volume of 25 µL, each volume multiplied by the number of samples.
  5. From each patch that grew one YPG, take an amount of yeast corresponding to the size of a colony with a pipet tip and crush the cells in an empty PCR well (use PCR strips or 96-well PCR plates depending on the number of samples).
  6. Add 25 µL of PCR mix in each well. For each pair of primers, always include the following controls: one well without cells and one well with cells from the progenitor strain used in step 9A.
  7. The PCR program is 94°C for 2 min, 30 cycles of 94°C for 30 s, 55°C (or Tm – 5°C) for 30 s, 68°C for 1 min/kb and a final elongation at 68°C for 5 min.
  8. Run 5 µL of PCR products in a 1% agarose gel.
  9. For all samples that gave a band of expected size, purify the remaining PCR products using Macherey-Nagel PCR clean-up kit.
  10. Send for sequencing (GATC Supreme run recommended) one or both of the PCR primers. Additional primers may be necessary to sequence the entire insert if PCR product is larger than 1.6 kb.

 

11. Remove plasmid

  1. For clones with correct sequence (check for point mutations), patch cells from YPG plate on 5-FOA plate. Grow for one day at 30°C.
  2. Grow cells from 5-FOA patch into 5 mL of YPD at 30°C overnight.
  3. Glycerol stock 1 mL of culture and keep in GY -80°C collection.

 

 

Comments on design of gRNA oligos:

sgRNA must be designed to match 20 nucleotides immediately upstream (5') of an 'NGG' PAM site of the genome.

Example for GAL3 mutation at position W117 (the PAM sequence tgg is the codon of W117 itself).
gRNA matches GAL3 at position 329 within ORF
>chrIV_463762 NoNAG
gRNA Sequence:
TAGATCCGTCTGTGTCGGAAtgg
Oligo1: 1P29
GATCTAGATCCGTCTGTGTCGGAAGTTTTAGAGCTAG
Oligo2: 1P30
CTAGCTCTAAAACTTCCGACACAGACGGATCTA