Delitto Perfetto
Method for Allele-Replacement or Site-Directed Mutagenesis
Adapted from Storici & Resnick Methods in Enzymology, 2006 409:329-345
Please note that we can NOT provide you with plasmids pGSKU and pGSHU mentioned here, as this would violate a Material and Transfer Agreement. These plasmids should be requested directly from the Resnick lab.
Takara Ex Polymerase is from Takara Bio Inc. , distributed in France by Lonza Bioscience SARL.
1. Primer design:
Note: it is important to follow the Reverse/Forward design below so that KlURA3 gets inserted in reverse direction as compared to the targeted gene (facilitates pop-out selection).
P.I: 5’-[50nt of Reverse Sequence In Your Gene]-TTCGTACGCTGCAGGTCGAC-3’
P.II: 5’-[50nt of Forward Sequence In Your Gene]-tagggataacagggtaat-CCGCGCGTTGGCCGATTCAT-3’
P.UI: 5’- GAGCAATGAACCCAATAACGAAATC -3’ [1B20]
P.UE: 5’-[a genomic sequence 100 to 500nt upstream the one entered in P.I]-3’
P.DI: 5’- ACGAGAACGGATGTAAGCATCACC -3’ (Reverse within SceI CDS) [1F29]
P.DE: 5’-[a genomic sequence 100 to 500nt upstream the one entered in P.II]-3’.
2. Integration of the pCORE cassette.
- PCR with primer-I and primer-II on pGSKU template using Takara Ex Taq Polymerase (and not the usual Taq) (product = 4.8 Kb) using the following program:
2 min at 94°C
then 32 cycles of [ 30s at 94°C, 30s at 57°C, 4min at 72°C ]
Qiaquick purif.
- Transform desired strain by selecting on -U plates.
- Replica-plate on YPD+G418 plates, select G418R colonies.
- colony PCRs to verify integration:
PCR with P.UI and P.UE
PCR with P.DI and P.DE
3. Pop-Out replacement
Inoculate 5ml YPD starter culture O/N
Inoculate 50 ml of synthetic complete medium containing 2% galactose with 1.5 ml of the O/N starter, shake at 30°C for 4hours (expression of GAL1-SceI, which will induce a DSB at the insertion site).
Transfer culture to a 50ml tube, spin cells down.
Wash cells with water, spin again.
Resuspend cells in 250ul LiAc 0.1M (or less if few transformations are done).
Aliquot 50ul of cell suspension in 1.5 ml tubes, spin cells down.
Proceed with transformation by adding PEG, LiAC 1M, ssDNA carrier and the DNA that will mediate the pop-out (either PCR product or designed-oligos).
Plate cell dilutions (range of 10-10,000 fold) on YPD plates and incubate at 30°C O/N.
Replica-plate to 5-FoA plate, incubate 3 days at 30°C
Replica-plate on YPD+G418.
Isolate G418R colonies.
Dernière mise à jour : ( 07-05-2010 )